ID: 985972421

View in Genome Browser
Species Human (GRCh38)
Location 5:3388879-3388901
Sequence GACTGAAGGAAGGTGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985972421_985972434 25 Left 985972421 5:3388879-3388901 CCAGGTCCCACCTTCCTTCAGTC No data
Right 985972434 5:3388927-3388949 GTACGGGATTTGGTCTCAAGTGG No data
985972421_985972427 2 Left 985972421 5:3388879-3388901 CCAGGTCCCACCTTCCTTCAGTC No data
Right 985972427 5:3388904-3388926 TCATCACCGCAGTGTCCTGTGGG No data
985972421_985972428 3 Left 985972421 5:3388879-3388901 CCAGGTCCCACCTTCCTTCAGTC No data
Right 985972428 5:3388905-3388927 CATCACCGCAGTGTCCTGTGGGG No data
985972421_985972430 8 Left 985972421 5:3388879-3388901 CCAGGTCCCACCTTCCTTCAGTC No data
Right 985972430 5:3388910-3388932 CCGCAGTGTCCTGTGGGGTACGG No data
985972421_985972431 9 Left 985972421 5:3388879-3388901 CCAGGTCCCACCTTCCTTCAGTC No data
Right 985972431 5:3388911-3388933 CGCAGTGTCCTGTGGGGTACGGG No data
985972421_985972432 15 Left 985972421 5:3388879-3388901 CCAGGTCCCACCTTCCTTCAGTC No data
Right 985972432 5:3388917-3388939 GTCCTGTGGGGTACGGGATTTGG No data
985972421_985972426 1 Left 985972421 5:3388879-3388901 CCAGGTCCCACCTTCCTTCAGTC No data
Right 985972426 5:3388903-3388925 TTCATCACCGCAGTGTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985972421 Original CRISPR GACTGAAGGAAGGTGGGACC TGG (reversed) Intergenic
No off target data available for this crispr