ID: 985976754

View in Genome Browser
Species Human (GRCh38)
Location 5:3425322-3425344
Sequence ATAACATATCTGGTCAACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985976749_985976754 27 Left 985976749 5:3425272-3425294 CCTTGAAAGTTTAGGCATGATGC No data
Right 985976754 5:3425322-3425344 ATAACATATCTGGTCAACGAGGG No data
985976748_985976754 28 Left 985976748 5:3425271-3425293 CCCTTGAAAGTTTAGGCATGATG No data
Right 985976754 5:3425322-3425344 ATAACATATCTGGTCAACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985976754 Original CRISPR ATAACATATCTGGTCAACGA GGG Intergenic
No off target data available for this crispr