ID: 985983773

View in Genome Browser
Species Human (GRCh38)
Location 5:3495526-3495548
Sequence AAATATTCACAGATGAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985983773_985983774 7 Left 985983773 5:3495526-3495548 CCTTGTCTCATCTGTGAATATTT No data
Right 985983774 5:3495556-3495578 GCTTTCATTGCTGAGAAAAGTGG No data
985983773_985983775 29 Left 985983773 5:3495526-3495548 CCTTGTCTCATCTGTGAATATTT No data
Right 985983775 5:3495578-3495600 GTCATTAGATATAGAATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985983773 Original CRISPR AAATATTCACAGATGAGACA AGG (reversed) Intergenic
No off target data available for this crispr