ID: 985985952

View in Genome Browser
Species Human (GRCh38)
Location 5:3516480-3516502
Sequence GTGGGATTTGATTGGATCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985985952_985985959 0 Left 985985952 5:3516480-3516502 CCCGTGATCCAATCAAATCCCAC No data
Right 985985959 5:3516503-3516525 TAGGCCCCACCTCTAGCATTGGG No data
985985952_985985965 24 Left 985985952 5:3516480-3516502 CCCGTGATCCAATCAAATCCCAC No data
Right 985985965 5:3516527-3516549 TTACATGTCAACATGAGATTTGG 0: 12
1: 663
2: 3144
3: 7631
4: 15525
985985952_985985958 -1 Left 985985952 5:3516480-3516502 CCCGTGATCCAATCAAATCCCAC No data
Right 985985958 5:3516502-3516524 CTAGGCCCCACCTCTAGCATTGG No data
985985952_985985960 1 Left 985985952 5:3516480-3516502 CCCGTGATCCAATCAAATCCCAC No data
Right 985985960 5:3516504-3516526 AGGCCCCACCTCTAGCATTGGGG 0: 9
1: 166
2: 1034
3: 2686
4: 3552
985985952_985985967 28 Left 985985952 5:3516480-3516502 CCCGTGATCCAATCAAATCCCAC No data
Right 985985967 5:3516531-3516553 ATGTCAACATGAGATTTGGGTGG No data
985985952_985985968 29 Left 985985952 5:3516480-3516502 CCCGTGATCCAATCAAATCCCAC No data
Right 985985968 5:3516532-3516554 TGTCAACATGAGATTTGGGTGGG No data
985985952_985985966 25 Left 985985952 5:3516480-3516502 CCCGTGATCCAATCAAATCCCAC No data
Right 985985966 5:3516528-3516550 TACATGTCAACATGAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985985952 Original CRISPR GTGGGATTTGATTGGATCAC GGG (reversed) Intergenic
No off target data available for this crispr