ID: 985987966

View in Genome Browser
Species Human (GRCh38)
Location 5:3533298-3533320
Sequence TGCCATAGACATTTTGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985987966_985987972 19 Left 985987966 5:3533298-3533320 CCCGGCCCAAAATGTCTATGGCA No data
Right 985987972 5:3533340-3533362 GTCTGCCAATTTAATCAAAAAGG No data
985987966_985987971 -3 Left 985987966 5:3533298-3533320 CCCGGCCCAAAATGTCTATGGCA No data
Right 985987971 5:3533318-3533340 GCACTGAGGTTGAGAAACTCTGG No data
985987966_985987974 25 Left 985987966 5:3533298-3533320 CCCGGCCCAAAATGTCTATGGCA No data
Right 985987974 5:3533346-3533368 CAATTTAATCAAAAAGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985987966 Original CRISPR TGCCATAGACATTTTGGGCC GGG (reversed) Intergenic
No off target data available for this crispr