ID: 985987987

View in Genome Browser
Species Human (GRCh38)
Location 5:3533420-3533442
Sequence TCTGGGGCCCCTCCCAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985987980_985987987 13 Left 985987980 5:3533384-3533406 CCCACAGTGTGGTCGTGTCCTAT No data
Right 985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG No data
985987982_985987987 -5 Left 985987982 5:3533402-3533424 CCTATAAAGCTAAGAGCATCTGG No data
Right 985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG No data
985987977_985987987 28 Left 985987977 5:3533369-3533391 CCTGAAGATGAGGGCCCCACAGT No data
Right 985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG No data
985987979_985987987 14 Left 985987979 5:3533383-3533405 CCCCACAGTGTGGTCGTGTCCTA No data
Right 985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG No data
985987981_985987987 12 Left 985987981 5:3533385-3533407 CCACAGTGTGGTCGTGTCCTATA No data
Right 985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985987987 Original CRISPR TCTGGGGCCCCTCCCAGAGG CGG Intergenic
No off target data available for this crispr