ID: 985994111

View in Genome Browser
Species Human (GRCh38)
Location 5:3587121-3587143
Sequence CGACACAACAAGAGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985994107_985994111 -7 Left 985994107 5:3587105-3587127 CCGAGTGGCCAGGAGGCGACACA No data
Right 985994111 5:3587121-3587143 CGACACAACAAGAGGCTGCTGGG No data
985994105_985994111 0 Left 985994105 5:3587098-3587120 CCATGCACCGAGTGGCCAGGAGG No data
Right 985994111 5:3587121-3587143 CGACACAACAAGAGGCTGCTGGG No data
985994101_985994111 10 Left 985994101 5:3587088-3587110 CCAGGGATGCCCATGCACCGAGT No data
Right 985994111 5:3587121-3587143 CGACACAACAAGAGGCTGCTGGG No data
985994104_985994111 1 Left 985994104 5:3587097-3587119 CCCATGCACCGAGTGGCCAGGAG No data
Right 985994111 5:3587121-3587143 CGACACAACAAGAGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985994111 Original CRISPR CGACACAACAAGAGGCTGCT GGG Intergenic
No off target data available for this crispr