ID: 985994627

View in Genome Browser
Species Human (GRCh38)
Location 5:3591168-3591190
Sequence CCACCCGGGAACGCGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985994627_985994635 2 Left 985994627 5:3591168-3591190 CCGCCCGCCGCGTTCCCGGGTGG No data
Right 985994635 5:3591193-3591215 TCCCCACGCTGCTGAGGACCTGG No data
985994627_985994642 24 Left 985994627 5:3591168-3591190 CCGCCCGCCGCGTTCCCGGGTGG No data
Right 985994642 5:3591215-3591237 GTTCCGCGATGCTTGCCGCGGGG No data
985994627_985994641 23 Left 985994627 5:3591168-3591190 CCGCCCGCCGCGTTCCCGGGTGG No data
Right 985994641 5:3591214-3591236 GGTTCCGCGATGCTTGCCGCGGG No data
985994627_985994640 22 Left 985994627 5:3591168-3591190 CCGCCCGCCGCGTTCCCGGGTGG No data
Right 985994640 5:3591213-3591235 TGGTTCCGCGATGCTTGCCGCGG No data
985994627_985994634 -4 Left 985994627 5:3591168-3591190 CCGCCCGCCGCGTTCCCGGGTGG No data
Right 985994634 5:3591187-3591209 GTGGTGTCCCCACGCTGCTGAGG No data
985994627_985994643 25 Left 985994627 5:3591168-3591190 CCGCCCGCCGCGTTCCCGGGTGG No data
Right 985994643 5:3591216-3591238 TTCCGCGATGCTTGCCGCGGGGG No data
985994627_985994644 26 Left 985994627 5:3591168-3591190 CCGCCCGCCGCGTTCCCGGGTGG No data
Right 985994644 5:3591217-3591239 TCCGCGATGCTTGCCGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985994627 Original CRISPR CCACCCGGGAACGCGGCGGG CGG (reversed) Intergenic
No off target data available for this crispr