ID: 985994774

View in Genome Browser
Species Human (GRCh38)
Location 5:3591810-3591832
Sequence CCAAAGGCTGGTCCCACAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985994762_985994774 24 Left 985994762 5:3591763-3591785 CCACCCGTTGCATCCCGCGGCAG No data
Right 985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG No data
985994765_985994774 20 Left 985994765 5:3591767-3591789 CCGTTGCATCCCGCGGCAGGTCT No data
Right 985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG No data
985994767_985994774 10 Left 985994767 5:3591777-3591799 CCGCGGCAGGTCTGTGTCGCCTG No data
Right 985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG No data
985994766_985994774 11 Left 985994766 5:3591776-3591798 CCCGCGGCAGGTCTGTGTCGCCT No data
Right 985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG No data
985994771_985994774 -9 Left 985994771 5:3591796-3591818 CCTGGTTCTCGGCGCCAAAGGCT No data
Right 985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG No data
985994760_985994774 29 Left 985994760 5:3591758-3591780 CCGCGCCACCCGTTGCATCCCGC No data
Right 985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG No data
985994764_985994774 21 Left 985994764 5:3591766-3591788 CCCGTTGCATCCCGCGGCAGGTC No data
Right 985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985994774 Original CRISPR CCAAAGGCTGGTCCCACAGA CGG Intergenic
No off target data available for this crispr