ID: 985994955

View in Genome Browser
Species Human (GRCh38)
Location 5:3592649-3592671
Sequence GCCTCAGCCACCCCCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985994948_985994955 10 Left 985994948 5:3592616-3592638 CCAGGAGCAACTTCCGGAGCAGC No data
Right 985994955 5:3592649-3592671 GCCTCAGCCACCCCCTTTGGAGG No data
985994945_985994955 19 Left 985994945 5:3592607-3592629 CCAGCTCCGCCAGGAGCAACTTC No data
Right 985994955 5:3592649-3592671 GCCTCAGCCACCCCCTTTGGAGG No data
985994943_985994955 29 Left 985994943 5:3592597-3592619 CCGGGTGCGGCCAGCTCCGCCAG No data
Right 985994955 5:3592649-3592671 GCCTCAGCCACCCCCTTTGGAGG No data
985994947_985994955 13 Left 985994947 5:3592613-3592635 CCGCCAGGAGCAACTTCCGGAGC No data
Right 985994955 5:3592649-3592671 GCCTCAGCCACCCCCTTTGGAGG No data
985994952_985994955 -3 Left 985994952 5:3592629-3592651 CCGGAGCAGCGGCAGGGCCTGCC No data
Right 985994955 5:3592649-3592671 GCCTCAGCCACCCCCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985994955 Original CRISPR GCCTCAGCCACCCCCTTTGG AGG Intergenic
No off target data available for this crispr