ID: 985995135

View in Genome Browser
Species Human (GRCh38)
Location 5:3593510-3593532
Sequence CCTCAAAACACCAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985995135_985995146 28 Left 985995135 5:3593510-3593532 CCCAGCTCCCTGGTGTTTTGAGG No data
Right 985995146 5:3593561-3593583 CAATGGAGGTGATGCAGCCGGGG No data
985995135_985995141 11 Left 985995135 5:3593510-3593532 CCCAGCTCCCTGGTGTTTTGAGG No data
Right 985995141 5:3593544-3593566 ACTTTGTGATGTGATGCCAATGG No data
985995135_985995142 14 Left 985995135 5:3593510-3593532 CCCAGCTCCCTGGTGTTTTGAGG No data
Right 985995142 5:3593547-3593569 TTGTGATGTGATGCCAATGGAGG No data
985995135_985995145 27 Left 985995135 5:3593510-3593532 CCCAGCTCCCTGGTGTTTTGAGG No data
Right 985995145 5:3593560-3593582 CCAATGGAGGTGATGCAGCCGGG No data
985995135_985995143 26 Left 985995135 5:3593510-3593532 CCCAGCTCCCTGGTGTTTTGAGG No data
Right 985995143 5:3593559-3593581 GCCAATGGAGGTGATGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985995135 Original CRISPR CCTCAAAACACCAGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr