ID: 985995552

View in Genome Browser
Species Human (GRCh38)
Location 5:3595387-3595409
Sequence CGCGCGGCCGGGGCCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985995552_985995565 -7 Left 985995552 5:3595387-3595409 CCCCTGGAGGCCCCGGCCGCGCG No data
Right 985995565 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
985995552_985995572 25 Left 985995552 5:3595387-3595409 CCCCTGGAGGCCCCGGCCGCGCG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985995552 Original CRISPR CGCGCGGCCGGGGCCTCCAG GGG (reversed) Intergenic
No off target data available for this crispr