ID: 985995553 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:3595388-3595410 |
| Sequence | CCGCGCGGCCGGGGCCTCCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985995553_985995572 | 24 | Left | 985995553 | 5:3595388-3595410 | CCCTGGAGGCCCCGGCCGCGCGG | No data | ||
| Right | 985995572 | 5:3595435-3595457 | CCTCGCTGTCACCAGCGTCCAGG | No data | ||||
| 985995553_985995565 | -8 | Left | 985995553 | 5:3595388-3595410 | CCCTGGAGGCCCCGGCCGCGCGG | No data | ||
| Right | 985995565 | 5:3595403-3595425 | CCGCGCGGGACTCGGGGGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985995553 | Original CRISPR | CCGCGCGGCCGGGGCCTCCA GGG (reversed) | Intergenic | ||