ID: 985995555 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:3595389-3595411 |
| Sequence | CCCGCGCGGCCGGGGCCTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985995555_985995573 | 30 | Left | 985995555 | 5:3595389-3595411 | CCTGGAGGCCCCGGCCGCGCGGG | No data | ||
| Right | 985995573 | 5:3595442-3595464 | GTCACCAGCGTCCAGGCCGCCGG | No data | ||||
| 985995555_985995565 | -9 | Left | 985995555 | 5:3595389-3595411 | CCTGGAGGCCCCGGCCGCGCGGG | No data | ||
| Right | 985995565 | 5:3595403-3595425 | CCGCGCGGGACTCGGGGGAGAGG | No data | ||||
| 985995555_985995572 | 23 | Left | 985995555 | 5:3595389-3595411 | CCTGGAGGCCCCGGCCGCGCGGG | No data | ||
| Right | 985995572 | 5:3595435-3595457 | CCTCGCTGTCACCAGCGTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985995555 | Original CRISPR | CCCGCGCGGCCGGGGCCTCC AGG (reversed) | Intergenic | ||