ID: 985995559 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:3595397-3595419 |
| Sequence | CCCCGAGTCCCGCGCGGCCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985995559_985995573 | 22 | Left | 985995559 | 5:3595397-3595419 | CCCCGGCCGCGCGGGACTCGGGG | No data | ||
| Right | 985995573 | 5:3595442-3595464 | GTCACCAGCGTCCAGGCCGCCGG | No data | ||||
| 985995559_985995572 | 15 | Left | 985995559 | 5:3595397-3595419 | CCCCGGCCGCGCGGGACTCGGGG | No data | ||
| Right | 985995572 | 5:3595435-3595457 | CCTCGCTGTCACCAGCGTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985995559 | Original CRISPR | CCCCGAGTCCCGCGCGGCCG GGG (reversed) | Intergenic | ||