ID: 985995564

View in Genome Browser
Species Human (GRCh38)
Location 5:3595403-3595425
Sequence CCTCTCCCCCGAGTCCCGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985995564_985995573 16 Left 985995564 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
Right 985995573 5:3595442-3595464 GTCACCAGCGTCCAGGCCGCCGG No data
985995564_985995572 9 Left 985995564 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985995564 Original CRISPR CCTCTCCCCCGAGTCCCGCG CGG (reversed) Intergenic