ID: 985995565

View in Genome Browser
Species Human (GRCh38)
Location 5:3595403-3595425
Sequence CCGCGCGGGACTCGGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985995555_985995565 -9 Left 985995555 5:3595389-3595411 CCTGGAGGCCCCGGCCGCGCGGG No data
Right 985995565 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
985995552_985995565 -7 Left 985995552 5:3595387-3595409 CCCCTGGAGGCCCCGGCCGCGCG No data
Right 985995565 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
985995547_985995565 18 Left 985995547 5:3595362-3595384 CCGGGTGCACTTCTGCCAAAGAT No data
Right 985995565 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
985995553_985995565 -8 Left 985995553 5:3595388-3595410 CCCTGGAGGCCCCGGCCGCGCGG No data
Right 985995565 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
985995550_985995565 3 Left 985995550 5:3595377-3595399 CCAAAGATGTCCCCTGGAGGCCC No data
Right 985995565 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985995565 Original CRISPR CCGCGCGGGACTCGGGGGAG AGG Intergenic