ID: 985995572

View in Genome Browser
Species Human (GRCh38)
Location 5:3595435-3595457
Sequence CCTCGCTGTCACCAGCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985995555_985995572 23 Left 985995555 5:3595389-3595411 CCTGGAGGCCCCGGCCGCGCGGG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data
985995564_985995572 9 Left 985995564 5:3595403-3595425 CCGCGCGGGACTCGGGGGAGAGG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data
985995559_985995572 15 Left 985995559 5:3595397-3595419 CCCCGGCCGCGCGGGACTCGGGG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data
985995561_985995572 14 Left 985995561 5:3595398-3595420 CCCGGCCGCGCGGGACTCGGGGG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data
985995563_985995572 13 Left 985995563 5:3595399-3595421 CCGGCCGCGCGGGACTCGGGGGA No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data
985995553_985995572 24 Left 985995553 5:3595388-3595410 CCCTGGAGGCCCCGGCCGCGCGG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data
985995552_985995572 25 Left 985995552 5:3595387-3595409 CCCCTGGAGGCCCCGGCCGCGCG No data
Right 985995572 5:3595435-3595457 CCTCGCTGTCACCAGCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985995572 Original CRISPR CCTCGCTGTCACCAGCGTCC AGG Intergenic