ID: 985995783

View in Genome Browser
Species Human (GRCh38)
Location 5:3596177-3596199
Sequence CGGCCGCGGCCAGCACCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 251}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985995783_985995789 4 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995789 5:3596204-3596226 GGCGGCTGCCGCCGCCTCGTCGG 0: 1
1: 0
2: 0
3: 16
4: 176
985995783_985995801 29 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995801 5:3596229-3596251 CGACCGGGGGCCGCGGAGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 227
985995783_985995798 22 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995798 5:3596222-3596244 GTCGGGCCGACCGGGGGCCGCGG 0: 1
1: 1
2: 0
3: 14
4: 176
985995783_985995790 5 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995790 5:3596205-3596227 GCGGCTGCCGCCGCCTCGTCGGG 0: 1
1: 0
2: 4
3: 27
4: 231
985995783_985995792 13 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995792 5:3596213-3596235 CGCCGCCTCGTCGGGCCGACCGG 0: 1
1: 0
2: 0
3: 1
4: 45
985995783_985995793 14 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995793 5:3596214-3596236 GCCGCCTCGTCGGGCCGACCGGG 0: 1
1: 0
2: 0
3: 3
4: 57
985995783_985995800 28 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995800 5:3596228-3596250 CCGACCGGGGGCCGCGGAGCTGG 0: 1
1: 0
2: 0
3: 25
4: 286
985995783_985995795 15 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995795 5:3596215-3596237 CCGCCTCGTCGGGCCGACCGGGG 0: 1
1: 0
2: 0
3: 0
4: 42
985995783_985995796 16 Left 985995783 5:3596177-3596199 CCCGGGGGTGCTGGCCGCGGCCG 0: 1
1: 0
2: 0
3: 22
4: 251
Right 985995796 5:3596216-3596238 CGCCTCGTCGGGCCGACCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985995783 Original CRISPR CGGCCGCGGCCAGCACCCCC GGG (reversed) Exonic
900166859 1:1247339-1247361 CGAGGCCGGCCAGCACCCCCAGG - Intergenic
900683266 1:3930854-3930876 CTGCCGTTGCCAGCAGCCCCGGG + Intergenic
900992181 1:6103205-6103227 TGTCCGTGGCCAGCACCCCGGGG - Exonic
900998030 1:6133389-6133411 CGTCCGCCGCCTGCAGCCCCAGG - Intronic
901022151 1:6260956-6260978 TGGCCGCCGCCAGCATGCCCCGG - Exonic
901084544 1:6602646-6602668 TGGCGGCGGCCAGCACCGCACGG + Exonic
904093379 1:27960111-27960133 CGGCGGTGCCCAGCACGCCCAGG - Exonic
906095787 1:43223074-43223096 GGACCCTGGCCAGCACCCCCAGG - Intronic
908195450 1:61742620-61742642 CGGCCGGGGGCAGCTCCCTCGGG + Intronic
910758197 1:90712572-90712594 CTGCCTCGGCCAGCAACTCCAGG + Exonic
911664713 1:100539542-100539564 CCGCGGCGGCCAGCAGCGCCGGG - Exonic
912305169 1:108560009-108560031 CGGCCGCGGCCTGCAGCGCACGG - Intergenic
912499875 1:110114694-110114716 TGGCTGCAGCCAGCACTCCCAGG + Intergenic
915247643 1:154567908-154567930 CCGCGGCGGCCGGCACCACCTGG + Exonic
915341437 1:155178865-155178887 CGGCGGCGGGCAGGGCCCCCGGG - Intronic
1062858008 10:789168-789190 GGGCCCCAGCCAGCGCCCCCTGG - Intergenic
1062899310 10:1130415-1130437 CGGCTGCAGCCAGCAGGCCCCGG + Exonic
1063395636 10:5684969-5684991 CGCCCGCGGCGAGGACCCCGGGG + Exonic
1066758077 10:38730371-38730393 CGGACGCGGCCCGGACCCCGTGG + Intergenic
1067047540 10:42992968-42992990 CAGCCTGCGCCAGCACCCCCAGG + Intergenic
1067344429 10:45427548-45427570 CGCCCGCGCGCAGGACCCCCGGG - Intronic
1067769896 10:49115537-49115559 CGGCCGCCGCCAGCCCGCCCCGG + Intergenic
1069589455 10:69632820-69632842 TGGCGGGGGCCAGGACCCCCTGG - Exonic
1069698319 10:70404188-70404210 CGGCCTCAGCCAGCAGCCTCAGG - Intergenic
1069813257 10:71178058-71178080 AGACAGCGGCCAACACCCCCAGG + Intergenic
1070800858 10:79243652-79243674 CGGCCGCGGCGAGCGACTCCGGG - Intronic
1072248947 10:93566825-93566847 CCACCGCGGCCAGCACCAGCCGG - Exonic
1075521518 10:123146437-123146459 GGGCCGCTGCGCGCACCCCCTGG + Intergenic
1075677708 10:124307723-124307745 CAGCCGCAGCCAGCACCAGCAGG + Intergenic
1076522852 10:131091605-131091627 CAGCAGCAGCCAGCGCCCCCAGG - Intergenic
1077063393 11:627236-627258 CGGCCGCGCCCAGCGATCCCGGG + Intergenic
1077086590 11:755429-755451 CCGCCGCGCCCAGCTCCCCTTGG + Intronic
1077187552 11:1242150-1242172 AGGCCGAGACCAGCACGCCCAGG + Exonic
1077489173 11:2852665-2852687 CAGCCGGGGCCAGGGCCCCCTGG + Intergenic
1080012402 11:27472245-27472267 CGGCCGAGCCGAGCAGCCCCAGG + Exonic
1080036679 11:27719129-27719151 CCGCCCCCGCCTGCACCCCCGGG - Intronic
1080418594 11:32091454-32091476 AGGCCGCGGCCAGGGCCCCGTGG + Intronic
1082003760 11:47408695-47408717 CGGCCGGGTCCATCACGCCCGGG - Intronic
1082929006 11:58579551-58579573 CGTCCCCGGGCAGCAGCCCCAGG + Exonic
1083246117 11:61429648-61429670 CGGCTCCGGCCAGAGCCCCCAGG + Intronic
1084010414 11:66345285-66345307 CGTCCGCGGCCATCTCCCCACGG + Intergenic
1085266609 11:75241256-75241278 CGGCCGCGCGCAGCACCGTCAGG - Exonic
1088850443 11:113699616-113699638 CTGCACCGGCCAGCAGCCCCAGG + Exonic
1094377112 12:29801963-29801985 CGGCCGCCTGCAGCGCCCCCAGG - Intergenic
1095581578 12:43806290-43806312 CGGCCCCGGCCGGCGGCCCCAGG + Intronic
1095800659 12:46268032-46268054 CGGCCGCACGCAGCACCCCCCGG + Intronic
1096101011 12:48970492-48970514 CGGCCGCGGCCTCCGCCCTCGGG - Exonic
1096368474 12:51048367-51048389 CGACCGAGCCCAGCACACCCTGG - Exonic
1097248964 12:57621892-57621914 CGGCAGCGGCCAGTTCCCACAGG - Intronic
1100844449 12:98644744-98644766 CGGCCACGTCCTGCTCCCCCTGG - Exonic
1102025949 12:109714411-109714433 CGCCCGCGGCTTGCAGCCCCCGG - Exonic
1102329025 12:112013552-112013574 CGGCAGCGGCCTGCACACCAAGG + Exonic
1103746375 12:123127291-123127313 AGGCAGCTGCCAGCACCTCCTGG - Intronic
1103764746 12:123271924-123271946 CGGCCGCGCCCCGCGCCTCCGGG + Exonic
1105725742 13:23160427-23160449 GCGCCCCGGCCAGCACCGCCCGG + Intergenic
1106735697 13:32586396-32586418 CCGCCGCGGACAGCACCCGGGGG - Intergenic
1108508854 13:51136746-51136768 CGCCCAGGGCCAGGACCCCCAGG + Intergenic
1109062277 13:57633617-57633639 CGGCCTCGCTCAGCGCCCCCTGG - Exonic
1110450818 13:75636190-75636212 CGGCCGCGGCCGGGAGCCCGGGG + Intronic
1113737739 13:112690276-112690298 CGGCCGCCCCCTGCACCGCCCGG + Intergenic
1113757056 13:112819849-112819871 CGGACGCGCCCAGCGGCCCCCGG - Intronic
1115399251 14:32939161-32939183 CGGCCCCGGCCACCGCCCGCCGG + Intronic
1117802947 14:59464158-59464180 GGGCGGCGGCCAGCAGCACCAGG + Exonic
1117803219 14:59465321-59465343 CGGCCGAGCCCAGCTCCCCGCGG - Exonic
1118339097 14:64879825-64879847 CCGCCGCCGCCGCCACCCCCGGG - Exonic
1120843565 14:89107432-89107454 CGGCAGAGCCCAGCACCCACTGG - Intergenic
1121439373 14:93939173-93939195 CGGCAACGGCCCGCACCCGCCGG - Exonic
1122430229 14:101635606-101635628 CGGCCCCTACCAACACCCCCTGG - Intergenic
1122632382 14:103112914-103112936 CAGCCCCTGTCAGCACCCCCAGG + Intergenic
1123441480 15:20295104-20295126 CGGACGCGGCCCGGACCCCGTGG + Intergenic
1124500875 15:30225507-30225529 CGCCAGCGGCCTGGACCCCCAGG + Intergenic
1124742695 15:32313160-32313182 CGCCAGCGGCCTGGACCCCCAGG - Intergenic
1124789956 15:32718085-32718107 CGGCCGCGGCCAGAGCCGCCGGG - Exonic
1127165816 15:56243936-56243958 CGCCCGCGGCCCGCACACCCTGG - Intergenic
1128119203 15:65133444-65133466 CGGCCGCGGCCACCGCCTCCCGG - Exonic
1129361943 15:75029773-75029795 AGGCCTCTGCCACCACCCCCTGG + Intronic
1129503260 15:76059952-76059974 CGGCCGCGGCTCGCGCTCCCGGG - Exonic
1131055288 15:89371300-89371322 CGGCCGCGGCCGGACCTCCCGGG + Intergenic
1132251977 15:100341316-100341338 CCGCCGCTGCCCGCAGCCCCCGG - Exonic
1132320063 15:100919246-100919268 AGGCCGCCGCCAGCTCTCCCAGG - Exonic
1132549191 16:547390-547412 CGGCCGGGGCCACCACTTCCGGG - Exonic
1132558241 16:582132-582154 TGGCCACGGCCAGCAGCACCCGG + Intronic
1132577470 16:670600-670622 CCGCCCCACCCAGCACCCCCTGG - Intronic
1132751043 16:1457875-1457897 GGGAGGGGGCCAGCACCCCCAGG + Intronic
1132841027 16:1978636-1978658 CGGCCGCCGCCCCCACCCCCTGG + Exonic
1132891659 16:2207762-2207784 CGGGCGAGGCCAGCAGCCCCGGG - Intronic
1132995027 16:2818319-2818341 GAGCCAAGGCCAGCACCCCCGGG + Intronic
1133221475 16:4320861-4320883 CGGCCTCCCCCAGCACCCCCCGG + Intronic
1133232150 16:4371946-4371968 AGGCCGCGGCCTGCCCCGCCCGG + Exonic
1135335776 16:21599850-21599872 CGGCCGCCGCCGGCCCACCCGGG - Exonic
1135521719 16:23182976-23182998 CGGTAGCGGCCAGCTCTCCCGGG + Intronic
1137645063 16:50066427-50066449 CAGCAGCGGCCGGCACTCCCGGG + Exonic
1138619067 16:58197704-58197726 CGGCCGCGGGCAGCAGGGCCCGG - Exonic
1139436881 16:66941559-66941581 CGGCAGAGGCCAGCAGCTCCTGG - Exonic
1141636627 16:85317422-85317444 CAGCCTCAGCCAGCAGCCCCAGG + Intergenic
1142156466 16:88534715-88534737 CGGCCTCGGCCCGGAGCCCCAGG + Exonic
1142210690 16:88807085-88807107 CTGCTGCGCCCAGCAGCCCCGGG + Exonic
1142299619 16:89248685-89248707 AGGCTGCGGCCGGCACCTCCCGG - Intergenic
1203148272 16_KI270728v1_random:1816976-1816998 CGGACGCGGCCTGGACCCCGTGG - Intergenic
1142492977 17:290447-290469 CGGCCGCGGCACGCACCCCGGGG - Intronic
1142637754 17:1268503-1268525 CGGCCGCGCCCCGCAGCGCCCGG + Intergenic
1142764763 17:2058871-2058893 CGGCCCTGGCCCGCACCCCAGGG + Exonic
1143028305 17:3953643-3953665 AGGCCGCGGGCAGCATCCCTGGG - Intronic
1143837087 17:9701253-9701275 CGGCCGGGGCATGGACCCCCAGG - Intronic
1144109991 17:12021442-12021464 CGGCCCCGGCCGGCGCCCCTCGG + Intronic
1144666415 17:17105277-17105299 AGGCCTCAGCCAGCACCCCCAGG + Intronic
1144829063 17:18121630-18121652 CGGCGGCTGCCTGCACCTCCTGG - Exonic
1146511000 17:33448568-33448590 TGGCAGCTGCCAGCACCCCTTGG - Intronic
1147307371 17:39573473-39573495 CGGTCGCCGCCAGGACCCCAGGG - Intergenic
1147915301 17:43882133-43882155 CGGCTGCGGTCAGCTGCCCCTGG + Intronic
1148214126 17:45825248-45825270 TGCCCGCAGCCAGCACCACCAGG + Intronic
1148342812 17:46883690-46883712 AGGCCGTGCCCAGCACTCCCCGG - Intronic
1148493444 17:48037723-48037745 CCGCCGCGGCCCCCTCCCCCGGG + Exonic
1150003119 17:61454452-61454474 CGGCCGCCGCCAGCACCGCGGGG - Intronic
1150617680 17:66784838-66784860 CGTCGGCAGCCTGCACCCCCTGG + Intronic
1151156090 17:72123766-72123788 CGTGCGTGGCCGGCACCCCCGGG - Exonic
1151950786 17:77352551-77352573 CTGCGGCGGCCAGCAACCCCTGG + Intronic
1152185604 17:78854854-78854876 CGGCCCCGGACAGCAGCCTCAGG + Exonic
1152458920 17:80431273-80431295 CGGGTGGGGCCAGCACTCCCCGG - Intronic
1152579598 17:81160166-81160188 TGGCCACGGCCCCCACCCCCAGG + Intronic
1152632063 17:81414798-81414820 CGGAGGCGGCAGGCACCCCCTGG + Intronic
1152785670 17:82246712-82246734 CAGCCACGGCCAGCAAGCCCTGG + Intronic
1155877227 18:31102026-31102048 CGGCCGCGGCCCTCGCCCCGCGG - Exonic
1157290503 18:46406369-46406391 CAGCCCCGGCCAGCACCCACAGG - Intronic
1157383147 18:47238076-47238098 TGGCCCCAGCCAGCAGCCCCAGG + Intronic
1158930967 18:62325108-62325130 CGGGCGCGGCGAACACCCCCGGG + Intergenic
1160560964 18:79755538-79755560 CGGCCCCTGCCCCCACCCCCCGG - Exonic
1160725535 19:616417-616439 CGCCGGCGGCCTGGACCCCCAGG + Exonic
1160835496 19:1122818-1122840 GGGGCCGGGCCAGCACCCCCAGG - Intronic
1161282522 19:3453693-3453715 CGGCCGGCGCCAGCAGCCCGAGG + Intronic
1161370464 19:3908380-3908402 CGCCCGCGGCGAGCAGCCTCGGG + Intronic
1161566147 19:5003927-5003949 CGACCGCGGCCAACAACCCACGG - Intronic
1162387002 19:10365669-10365691 CGGCCTGGGCCAGCAGCCTCAGG + Exonic
1163607114 19:18281510-18281532 AGGCCGCGGCCACTCCCCCCCGG - Exonic
1166317886 19:41998899-41998921 CGGCCGCGGCCTGGCCCCGCCGG - Exonic
1166366341 19:42280394-42280416 GGGCCGCGCCCAGCCCCCGCTGG + Intronic
1167784773 19:51627870-51627892 CTGCCGCGCTCAGCACCCGCTGG - Exonic
927520089 2:23693294-23693316 CGGCCATGGCCAGCACGCCCAGG - Exonic
929756352 2:44768672-44768694 CGGCCGCGTCCCGGAGCCCCGGG - Intronic
929808668 2:45169955-45169977 GCGCCGCGGCCCGCACGCCCAGG + Intergenic
932790961 2:74654300-74654322 GGGCCGAGGCCAGTAGCCCCGGG + Exonic
934321395 2:91974811-91974833 CCGACGCGGCCAGGACCCCGTGG + Intergenic
934655694 2:96115978-96116000 CGGCGGCGGCCAGCGACACCAGG + Exonic
935170671 2:100609185-100609207 CAGCTGGGGCCAGCACCACCTGG - Intergenic
935196657 2:100820300-100820322 CGGGCGCGGCGAGCTCCTCCCGG - Exonic
936713793 2:115162040-115162062 CAGCCGCGGCCAGGCCCTCCCGG + Intronic
941367017 2:164621540-164621562 CGCCCGCGGCCCCCACCCACCGG - Exonic
946668292 2:222074377-222074399 CGGCTGCTGCCAGCAGCTCCTGG - Intergenic
947989603 2:234476346-234476368 TGGCTGTAGCCAGCACCCCCAGG + Intergenic
948234595 2:236379025-236379047 CGGCCCTGGCAAGCAGCCCCTGG - Intronic
948461153 2:238130606-238130628 AGGCCTCGGCCAGCCCCCCTCGG + Exonic
948508285 2:238446034-238446056 CGTCCGCGGCCCGCACCTGCTGG + Intronic
948767138 2:240228287-240228309 CAGCCACAGCCAGCACCTCCTGG - Intergenic
948843650 2:240672622-240672644 CGGCCACCGCTTGCACCCCCGGG - Intergenic
948868262 2:240786057-240786079 CAGATGCTGCCAGCACCCCCCGG + Intronic
949072669 2:242035437-242035459 AGGTCACGGCCAGCAGCCCCGGG + Intergenic
1169278457 20:4248797-4248819 CCGCCGCCGCCCGCGCCCCCCGG + Exonic
1169278593 20:4249252-4249274 TGGCCGCTGCCTGCACCGCCCGG - Intergenic
1170558001 20:17531077-17531099 CGGGCCCGGCCAGCTCGCCCAGG + Exonic
1170999044 20:21395970-21395992 CGGCCGCGTCCAGGGCCGCCAGG + Exonic
1174258539 20:49277381-49277403 CGTCCTCAGCAAGCACCCCCTGG - Intronic
1174452676 20:50629565-50629587 CTGGCCCGGCCAGCACCCCCAGG + Intronic
1175371983 20:58498525-58498547 CCCCCGAGGCCAGCAGCCCCTGG - Intronic
1175428810 20:58889004-58889026 CGGCACCGGCCTGCACCCCCAGG + Intronic
1175808900 20:61846918-61846940 ATGCCCCGGCCAGCACCCACAGG - Intronic
1175821658 20:61913335-61913357 CGGCTGAGGCCACCAGCCCCTGG - Intronic
1178922421 21:36747574-36747596 CGGGCGCAGCCACCACCCCTCGG - Intronic
1179529920 21:42011070-42011092 CGGCCGCGGCCAGGGCGTCCGGG + Intergenic
1179717896 21:43299402-43299424 GGGACGAGGCCAGCAGCCCCAGG + Intergenic
1179927963 21:44548642-44548664 CGTCCCCGGCCAGCGTCCCCTGG - Intronic
1179971417 21:44838185-44838207 TGGGCGGGGCCAGCAGCCCCAGG - Intergenic
1180609267 22:17085157-17085179 CACCCGGGGCCAGCACGCCCAGG - Exonic
1180801407 22:18633829-18633851 CGGCCCAGGCCGGAACCCCCAGG + Intergenic
1181108326 22:20587523-20587545 GGGCACCGGCCAGCACCCTCTGG + Exonic
1181477989 22:23180468-23180490 GCGCCGCGGCCACCTCCCCCCGG + Exonic
1182325819 22:29511957-29511979 CTGCCACGGCCACCTCCCCCGGG + Intronic
1183055014 22:35299898-35299920 CCGCCGCTGCCACCAACCCCGGG - Exonic
1183176874 22:36230823-36230845 AGGCCCCAGCCAGCATCCCCAGG + Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183715780 22:39532690-39532712 CGGACGCCGCCAGCAGCTCCAGG + Exonic
1184141790 22:42581882-42581904 CGGGGGCGGCCAGCATCGCCGGG - Intergenic
1184407259 22:44307177-44307199 CAGCCTCGGTCAGCAGCCCCAGG - Intronic
1184684117 22:46088283-46088305 CCGCCCTGGCCAGCACCCACCGG + Intronic
1184881375 22:47306523-47306545 CGCGCCCGGCCAGAACCCCCGGG - Intergenic
1185038179 22:48490277-48490299 CGGCCGCGGCGAGCCCCCTCCGG - Intronic
1185348224 22:50319842-50319864 CGGACAAGGCCTGCACCCCCAGG + Intronic
1185397404 22:50600245-50600267 CAGCCCCGGTCAGCACCCCGTGG + Intronic
950829651 3:15860355-15860377 CGGTCTCGGCCTGCAGCCCCCGG - Intergenic
951485271 3:23203193-23203215 CAGCCGCGGGCAGCAGCCTCAGG + Intronic
953013614 3:39052101-39052123 CGGACGCGGCCGGCAGCTCCGGG + Intronic
953705234 3:45225865-45225887 CCGCCGAGGCCAGCAGCCGCGGG + Exonic
954194773 3:48990120-48990142 CGGGCGGGCTCAGCACCCCCAGG + Exonic
954763884 3:52897227-52897249 CAGCCGCGGCCCGGCCCCCCTGG - Intronic
954778920 3:53045497-53045519 CGGCGGCGGCCGTCAGCCCCTGG - Intronic
956649848 3:71494530-71494552 CGGCGGCTGGCAGCATCCCCTGG + Intronic
961012811 3:123447714-123447736 CGGCGGCCGCCAGCACGGCCAGG + Exonic
961456651 3:127027898-127027920 AGGCTGCAGCCAGGACCCCCGGG - Intronic
964852065 3:161105356-161105378 GGGCCGCGGCCGGAAGCCCCTGG + Intronic
968074847 3:195810631-195810653 AGCCCACGGCCAGCACCTCCCGG + Intronic
968469036 4:769225-769247 CTGCAGCTGCCTGCACCCCCGGG + Exonic
968510043 4:991627-991649 CGGCAGCGCCCAGCACCCCGGGG - Exonic
968534093 4:1113001-1113023 CGCCCGCGGCCCCCACTCCCCGG + Intronic
968690253 4:1986526-1986548 GGGCAGCGGGCAGGACCCCCAGG + Intronic
968965429 4:3766873-3766895 CGGCCGAGGCCAGCGACACCAGG - Exonic
972247146 4:37257108-37257130 AGGCCACAGCCAGCACCACCTGG + Intronic
983229304 4:165113029-165113051 GGGCTGCGGCCAGAAGCCCCAGG - Intronic
984795729 4:183658873-183658895 CGGGCGCGGCGCGCAGCCCCGGG - Intronic
985994944 5:3592598-3592620 CGGGTGCGGCCAGCTCCGCCAGG + Intergenic
985995783 5:3596177-3596199 CGGCCGCGGCCAGCACCCCCGGG - Exonic
986693692 5:10333778-10333800 CGGCCCCTCCCAGCAGCCCCGGG - Intergenic
988437192 5:31190661-31190683 CAGCTGGGGCTAGCACCCCCAGG - Intergenic
997817862 5:137035538-137035560 GGGCAGCAGCCAGCAGCCCCAGG - Intronic
1000318932 5:160118776-160118798 CGCCCGCCCCCAGCACCCTCCGG - Intronic
1001382129 5:171311863-171311885 CGCCCCCCGCCCGCACCCCCCGG + Exonic
1002089939 5:176798507-176798529 CGGCCGCGGGCGAGACCCCCGGG + Intergenic
1003049467 6:2766234-2766256 CGGGGGCCGCCCGCACCCCCGGG + Exonic
1003552360 6:7109550-7109572 CGGCCCGGGCCCGCACCCCGTGG - Intronic
1004179085 6:13365387-13365409 CGGCGGCGGCCTGCACTCCGTGG - Exonic
1006162952 6:32048594-32048616 CCGCCACCGCCAGCTCCCCCAGG + Intronic
1006470206 6:34224337-34224359 CGGCCGCTGCCCGCACTCCCGGG + Intergenic
1013048757 6:106512107-106512129 CGCCCGCAGCCAGCCCCCCAAGG + Exonic
1019197772 6:170291874-170291896 CGGCCGCCGCCACCTTCCCCGGG + Intergenic
1019278326 7:187682-187704 TGGCCGGTCCCAGCACCCCCGGG + Intergenic
1019344673 7:523408-523430 GGGCGGCAGCCAACACCCCCTGG + Intergenic
1019989749 7:4682964-4682986 CGGCCTCGACCCCCACCCCCCGG + Intronic
1020055878 7:5117324-5117346 GCGCCGCGGACAGCGCCCCCAGG - Intergenic
1020275497 7:6622269-6622291 CGACCGCGGCCGGAGCCCCCGGG - Exonic
1021106560 7:16645462-16645484 CGGCCGCGGCCAGCCTGGCCGGG - Intronic
1022207540 7:28179614-28179636 GGGCCGCGCCCAGCGCCCCGGGG - Intronic
1022363317 7:29684848-29684870 CGGCGGCGGCCGGCACCGGCCGG - Intergenic
1022698069 7:32728912-32728934 CGGCGGCGGCCAGCACCGGCCGG + Intergenic
1023064794 7:36366886-36366908 CCGCCGCGGCCAGCCCTTCCCGG + Intronic
1023243697 7:38178264-38178286 CGCCCGCACCCAGCAGCCCCGGG - Exonic
1024256927 7:47546294-47546316 CGTCCACGTCCGGCACCCCCTGG + Intronic
1025012964 7:55413660-55413682 TGGCTGCGGCCAGCTCCTCCTGG + Intronic
1025144327 7:56491737-56491759 CTGCCGAGGACAGCAGCCCCAGG + Intergenic
1025992466 7:66506229-66506251 CGGCCACGGCCGCCACCCACCGG + Intergenic
1027224453 7:76235149-76235171 CGCCCGCGGCCAGGTCCCCGAGG - Exonic
1029054926 7:97732204-97732226 CAGCCGCGGCCAGCACCGCGCGG - Intronic
1029414761 7:100435938-100435960 CGGCTGCGGCCCGCAGCTCCAGG + Exonic
1029483727 7:100827238-100827260 CGGCCACTGCCAGCACGCTCCGG - Exonic
1029640305 7:101816122-101816144 CGCCCGCAGCCCCCACCCCCGGG - Intronic
1029711657 7:102303341-102303363 CAGCAGCCGACAGCACCCCCAGG + Intronic
1032119314 7:129144954-129144976 CCGCCGCCGCCACCGCCCCCGGG - Exonic
1033658462 7:143388496-143388518 CGGCCGATGCCATCAACCCCTGG + Exonic
1034432689 7:151049008-151049030 CGGCCGCTGCCCACATCCCCCGG - Exonic
1036556133 8:9862112-9862134 CTCCAGCTGCCAGCACCCCCAGG + Intergenic
1041689894 8:60678674-60678696 CGCCCGCCGCCAGCTCCCTCCGG - Intergenic
1044819273 8:96144983-96145005 CGGCGGCGGCCACGACCCCTCGG + Exonic
1045567033 8:103329918-103329940 CGGACGGAGCTAGCACCCCCAGG + Exonic
1049185117 8:141246411-141246433 AGGCCTCAGCCAACACCCCCAGG - Intronic
1049472855 8:142784020-142784042 CGGCCGCGGCCAGCAGACGGTGG - Intergenic
1049592985 8:143471077-143471099 CTGCTCCGGCCAGCACCCACTGG + Intronic
1049749368 8:144276115-144276137 CGGCAGGTCCCAGCACCCCCAGG + Intronic
1049845492 8:144798933-144798955 CGGCCGCGGCCGACTCACCCTGG - Exonic
1053165443 9:35841014-35841036 CCGCCCCGGCCACCACTCCCAGG - Intronic
1053372723 9:37576230-37576252 CGGCCGCGGCCCGGACTCCGCGG - Exonic
1054775807 9:69122391-69122413 CGGGCAGGGCGAGCACCCCCAGG - Intronic
1057091597 9:92263024-92263046 GGGCCGTGGCCAGCACCAGCAGG + Exonic
1057215288 9:93224466-93224488 CGGCCCTTCCCAGCACCCCCAGG - Intronic
1059309179 9:113376833-113376855 CGGCCGCGGCCAAGGCCCCTAGG - Intronic
1060139889 9:121201249-121201271 CGGCCGCAGCCCGCCCCCGCAGG - Intronic
1060481275 9:124017969-124017991 CGGCCGCGGCGCGCAAACCCAGG - Intronic
1061840501 9:133356300-133356322 AGGCCCCGGCCAGCGCCGCCTGG - Exonic
1062525042 9:136974797-136974819 GGGCCCCGGCCAGCATCCTCCGG - Intergenic
1062529316 9:136992947-136992969 CGGCTGAGGACATCACCCCCCGG + Exonic
1062617245 9:137403429-137403451 CAGCAGCAGCCAGCACACCCTGG + Intronic
1062617655 9:137405247-137405269 AGGGCTGGGCCAGCACCCCCGGG + Intronic
1185457891 X:319682-319704 AGGCGGCGTCCAGGACCCCCAGG - Intergenic
1185457951 X:319866-319888 CGGCGACGTCCAGGACCCCCAGG - Intergenic
1189002919 X:36964072-36964094 CCGCCGCGGCCTGGACCGCCCGG - Intergenic
1192503540 X:71667897-71667919 CGGCCGTGGCCGTCACCCCGTGG - Intergenic
1197766154 X:130060572-130060594 CGGCCGCGGCCGCCTCCGCCAGG + Intergenic
1200092923 X:153644239-153644261 CGGGCCGGGCCAGCGCCCCCTGG - Intronic