ID: 985997029

View in Genome Browser
Species Human (GRCh38)
Location 5:3602776-3602798
Sequence TCGGGAGCGGGTAGGAGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985997029_985997038 15 Left 985997029 5:3602776-3602798 CCACGGCTCCTACCCGCTCCCGA No data
Right 985997038 5:3602814-3602836 ACAGCCCTCCACCCCGTTCCTGG No data
985997029_985997044 27 Left 985997029 5:3602776-3602798 CCACGGCTCCTACCCGCTCCCGA No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997029_985997047 29 Left 985997029 5:3602776-3602798 CCACGGCTCCTACCCGCTCCCGA No data
Right 985997047 5:3602828-3602850 CGTTCCTGGTCCCTGTAGAGGGG No data
985997029_985997046 28 Left 985997029 5:3602776-3602798 CCACGGCTCCTACCCGCTCCCGA No data
Right 985997046 5:3602827-3602849 CCGTTCCTGGTCCCTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985997029 Original CRISPR TCGGGAGCGGGTAGGAGCCG TGG (reversed) Intergenic
No off target data available for this crispr