ID: 985997030

View in Genome Browser
Species Human (GRCh38)
Location 5:3602784-3602806
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985997030_985997038 7 Left 985997030 5:3602784-3602806 CCTACCCGCTCCCGACGCCCGCA No data
Right 985997038 5:3602814-3602836 ACAGCCCTCCACCCCGTTCCTGG No data
985997030_985997047 21 Left 985997030 5:3602784-3602806 CCTACCCGCTCCCGACGCCCGCA No data
Right 985997047 5:3602828-3602850 CGTTCCTGGTCCCTGTAGAGGGG No data
985997030_985997049 25 Left 985997030 5:3602784-3602806 CCTACCCGCTCCCGACGCCCGCA No data
Right 985997049 5:3602832-3602854 CCTGGTCCCTGTAGAGGGGAAGG No data
985997030_985997046 20 Left 985997030 5:3602784-3602806 CCTACCCGCTCCCGACGCCCGCA No data
Right 985997046 5:3602827-3602849 CCGTTCCTGGTCCCTGTAGAGGG No data
985997030_985997044 19 Left 985997030 5:3602784-3602806 CCTACCCGCTCCCGACGCCCGCA No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985997030 Original CRISPR TGCGGGCGTCGGGAGCGGGT AGG (reversed) Intergenic
No off target data available for this crispr