ID: 985997035

View in Genome Browser
Species Human (GRCh38)
Location 5:3602801-3602823
Sequence GGAGGGCTGTAGAAGGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985997035_985997047 4 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997047 5:3602828-3602850 CGTTCCTGGTCCCTGTAGAGGGG No data
985997035_985997049 8 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997049 5:3602832-3602854 CCTGGTCCCTGTAGAGGGGAAGG No data
985997035_985997038 -10 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997038 5:3602814-3602836 ACAGCCCTCCACCCCGTTCCTGG No data
985997035_985997046 3 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997046 5:3602827-3602849 CCGTTCCTGGTCCCTGTAGAGGG No data
985997035_985997044 2 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997035_985997053 30 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997053 5:3602854-3602876 GTCCTCTCCCTGCCCCGAGGCGG No data
985997035_985997052 27 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997052 5:3602851-3602873 AAGGTCCTCTCCCTGCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985997035 Original CRISPR GGAGGGCTGTAGAAGGATGC GGG (reversed) Intergenic
No off target data available for this crispr