ID: 985997037

View in Genome Browser
Species Human (GRCh38)
Location 5:3602808-3602830
Sequence ACGGGGTGGAGGGCTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985997037_985997046 -4 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997046 5:3602827-3602849 CCGTTCCTGGTCCCTGTAGAGGG No data
985997037_985997054 24 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997054 5:3602855-3602877 TCCTCTCCCTGCCCCGAGGCGGG No data
985997037_985997044 -5 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997037_985997053 23 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997053 5:3602854-3602876 GTCCTCTCCCTGCCCCGAGGCGG No data
985997037_985997047 -3 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997047 5:3602828-3602850 CGTTCCTGGTCCCTGTAGAGGGG No data
985997037_985997056 27 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997056 5:3602858-3602880 TCTCCCTGCCCCGAGGCGGGAGG No data
985997037_985997052 20 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997052 5:3602851-3602873 AAGGTCCTCTCCCTGCCCCGAGG No data
985997037_985997049 1 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997049 5:3602832-3602854 CCTGGTCCCTGTAGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985997037 Original CRISPR ACGGGGTGGAGGGCTGTAGA AGG (reversed) Intergenic
No off target data available for this crispr