ID: 985997044

View in Genome Browser
Species Human (GRCh38)
Location 5:3602826-3602848
Sequence CCCGTTCCTGGTCCCTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985997030_985997044 19 Left 985997030 5:3602784-3602806 CCTACCCGCTCCCGACGCCCGCA No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997032_985997044 14 Left 985997032 5:3602789-3602811 CCGCTCCCGACGCCCGCATCCTT No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997037_985997044 -5 Left 985997037 5:3602808-3602830 CCTTCTACAGCCCTCCACCCCGT No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997029_985997044 27 Left 985997029 5:3602776-3602798 CCACGGCTCCTACCCGCTCCCGA No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997031_985997044 15 Left 985997031 5:3602788-3602810 CCCGCTCCCGACGCCCGCATCCT No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997034_985997044 8 Left 985997034 5:3602795-3602817 CCGACGCCCGCATCCTTCTACAG No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997035_985997044 2 Left 985997035 5:3602801-3602823 CCCGCATCCTTCTACAGCCCTCC No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997033_985997044 9 Left 985997033 5:3602794-3602816 CCCGACGCCCGCATCCTTCTACA No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data
985997036_985997044 1 Left 985997036 5:3602802-3602824 CCGCATCCTTCTACAGCCCTCCA No data
Right 985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985997044 Original CRISPR CCCGTTCCTGGTCCCTGTAG AGG Intergenic
No off target data available for this crispr