ID: 985997839

View in Genome Browser
Species Human (GRCh38)
Location 5:3606565-3606587
Sequence CCCCGCCCGAGGGGAAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985997839_985997848 1 Left 985997839 5:3606565-3606587 CCCCTCCTTCCCCTCGGGCGGGG No data
Right 985997848 5:3606589-3606611 ATAAGTGGCCGCCCTCTCCGCGG No data
985997839_985997855 30 Left 985997839 5:3606565-3606587 CCCCTCCTTCCCCTCGGGCGGGG No data
Right 985997855 5:3606618-3606640 TTGGGCTTCTGAAGACGCAGCGG No data
985997839_985997850 11 Left 985997839 5:3606565-3606587 CCCCTCCTTCCCCTCGGGCGGGG No data
Right 985997850 5:3606599-3606621 GCCCTCTCCGCGGCTGCTGTTGG No data
985997839_985997852 12 Left 985997839 5:3606565-3606587 CCCCTCCTTCCCCTCGGGCGGGG No data
Right 985997852 5:3606600-3606622 CCCTCTCCGCGGCTGCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985997839 Original CRISPR CCCCGCCCGAGGGGAAGGAG GGG (reversed) Intergenic