ID: 985998362

View in Genome Browser
Species Human (GRCh38)
Location 5:3610524-3610546
Sequence CTGTTTCAGCAGGAGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985998356_985998362 -10 Left 985998356 5:3610511-3610533 CCCTCCTGAATTCCTGTTTCAGC No data
Right 985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG No data
985998354_985998362 -8 Left 985998354 5:3610509-3610531 CCCCCTCCTGAATTCCTGTTTCA No data
Right 985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG No data
985998353_985998362 -5 Left 985998353 5:3610506-3610528 CCACCCCCTCCTGAATTCCTGTT No data
Right 985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG No data
985998352_985998362 1 Left 985998352 5:3610500-3610522 CCTCAGCCACCCCCTCCTGAATT No data
Right 985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG No data
985998355_985998362 -9 Left 985998355 5:3610510-3610532 CCCCTCCTGAATTCCTGTTTCAG No data
Right 985998362 5:3610524-3610546 CTGTTTCAGCAGGAGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985998362 Original CRISPR CTGTTTCAGCAGGAGTGGAG TGG Intergenic
No off target data available for this crispr