ID: 986000402

View in Genome Browser
Species Human (GRCh38)
Location 5:3626749-3626771
Sequence TGACCTTGATGTGTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986000402_986000406 1 Left 986000402 5:3626749-3626771 CCCTCAAGAACACATCAAGGTCA No data
Right 986000406 5:3626773-3626795 AGGAAGACTCATTAGTTCCAGGG No data
986000402_986000405 0 Left 986000402 5:3626749-3626771 CCCTCAAGAACACATCAAGGTCA No data
Right 986000405 5:3626772-3626794 CAGGAAGACTCATTAGTTCCAGG No data
986000402_986000409 30 Left 986000402 5:3626749-3626771 CCCTCAAGAACACATCAAGGTCA No data
Right 986000409 5:3626802-3626824 TGCCTGTGATCTCACCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986000402 Original CRISPR TGACCTTGATGTGTTCTTGA GGG (reversed) Intergenic
No off target data available for this crispr