ID: 986001695

View in Genome Browser
Species Human (GRCh38)
Location 5:3635499-3635521
Sequence ATTCGCTGCATTGCAGACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986001695_986001696 -7 Left 986001695 5:3635499-3635521 CCGCTGTCTGCAATGCAGCGAAT No data
Right 986001696 5:3635515-3635537 AGCGAATGTGCGTGTCCCCCTGG No data
986001695_986001701 24 Left 986001695 5:3635499-3635521 CCGCTGTCTGCAATGCAGCGAAT No data
Right 986001701 5:3635546-3635568 TGTTGAAATCCTAATCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986001695 Original CRISPR ATTCGCTGCATTGCAGACAG CGG (reversed) Intergenic
No off target data available for this crispr