ID: 986002636

View in Genome Browser
Species Human (GRCh38)
Location 5:3642344-3642366
Sequence GTGGCCACTCACCTCTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986002636_986002641 -2 Left 986002636 5:3642344-3642366 CCAGGCTAGAGGTGAGTGGCCAC No data
Right 986002641 5:3642365-3642387 ACTCCCAGAGTGAGGCAGGGAGG No data
986002636_986002638 -6 Left 986002636 5:3642344-3642366 CCAGGCTAGAGGTGAGTGGCCAC No data
Right 986002638 5:3642361-3642383 GGCCACTCCCAGAGTGAGGCAGG No data
986002636_986002637 -10 Left 986002636 5:3642344-3642366 CCAGGCTAGAGGTGAGTGGCCAC No data
Right 986002637 5:3642357-3642379 GAGTGGCCACTCCCAGAGTGAGG No data
986002636_986002645 8 Left 986002636 5:3642344-3642366 CCAGGCTAGAGGTGAGTGGCCAC No data
Right 986002645 5:3642375-3642397 TGAGGCAGGGAGGACGGAGCAGG No data
986002636_986002639 -5 Left 986002636 5:3642344-3642366 CCAGGCTAGAGGTGAGTGGCCAC No data
Right 986002639 5:3642362-3642384 GCCACTCCCAGAGTGAGGCAGGG No data
986002636_986002644 2 Left 986002636 5:3642344-3642366 CCAGGCTAGAGGTGAGTGGCCAC No data
Right 986002644 5:3642369-3642391 CCAGAGTGAGGCAGGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986002636 Original CRISPR GTGGCCACTCACCTCTAGCC TGG (reversed) Intergenic
No off target data available for this crispr