ID: 986003575

View in Genome Browser
Species Human (GRCh38)
Location 5:3649259-3649281
Sequence GATGATCCACTGAGAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986003569_986003575 6 Left 986003569 5:3649230-3649252 CCTCGTGCACCAGTGTGAAGCCT No data
Right 986003575 5:3649259-3649281 GATGATCCACTGAGAGCTCTTGG No data
986003567_986003575 10 Left 986003567 5:3649226-3649248 CCCACCTCGTGCACCAGTGTGAA No data
Right 986003575 5:3649259-3649281 GATGATCCACTGAGAGCTCTTGG No data
986003568_986003575 9 Left 986003568 5:3649227-3649249 CCACCTCGTGCACCAGTGTGAAG No data
Right 986003575 5:3649259-3649281 GATGATCCACTGAGAGCTCTTGG No data
986003573_986003575 -3 Left 986003573 5:3649239-3649261 CCAGTGTGAAGCCTAATGGGGAT No data
Right 986003575 5:3649259-3649281 GATGATCCACTGAGAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986003575 Original CRISPR GATGATCCACTGAGAGCTCT TGG Intergenic
No off target data available for this crispr