ID: 986004180

View in Genome Browser
Species Human (GRCh38)
Location 5:3654272-3654294
Sequence CACAATTATGAAAATACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986004175_986004180 -4 Left 986004175 5:3654253-3654275 CCCACTGTGAAAGATTGCCCACA No data
Right 986004180 5:3654272-3654294 CACAATTATGAAAATACAGGAGG No data
986004176_986004180 -5 Left 986004176 5:3654254-3654276 CCACTGTGAAAGATTGCCCACAA No data
Right 986004180 5:3654272-3654294 CACAATTATGAAAATACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986004180 Original CRISPR CACAATTATGAAAATACAGG AGG Intergenic
No off target data available for this crispr