ID: 986007151

View in Genome Browser
Species Human (GRCh38)
Location 5:3677723-3677745
Sequence TGCTCCCCATGTGCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986007151_986007165 27 Left 986007151 5:3677723-3677745 CCTCCTGCAGCACATGGGGAGCA No data
Right 986007165 5:3677773-3677795 AGTGGGCACTGGCCAGTCCTGGG No data
986007151_986007158 9 Left 986007151 5:3677723-3677745 CCTCCTGCAGCACATGGGGAGCA No data
Right 986007158 5:3677755-3677777 GCAGACTCCCAGCCTGGCAGTGG No data
986007151_986007164 26 Left 986007151 5:3677723-3677745 CCTCCTGCAGCACATGGGGAGCA No data
Right 986007164 5:3677772-3677794 CAGTGGGCACTGGCCAGTCCTGG No data
986007151_986007159 10 Left 986007151 5:3677723-3677745 CCTCCTGCAGCACATGGGGAGCA No data
Right 986007159 5:3677756-3677778 CAGACTCCCAGCCTGGCAGTGGG No data
986007151_986007161 16 Left 986007151 5:3677723-3677745 CCTCCTGCAGCACATGGGGAGCA No data
Right 986007161 5:3677762-3677784 CCCAGCCTGGCAGTGGGCACTGG No data
986007151_986007154 3 Left 986007151 5:3677723-3677745 CCTCCTGCAGCACATGGGGAGCA No data
Right 986007154 5:3677749-3677771 GCCCCAGCAGACTCCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986007151 Original CRISPR TGCTCCCCATGTGCTGCAGG AGG (reversed) Intergenic
No off target data available for this crispr