ID: 986007692

View in Genome Browser
Species Human (GRCh38)
Location 5:3681867-3681889
Sequence CTAGGTCCCCAGTTCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986007689_986007692 17 Left 986007689 5:3681827-3681849 CCAGATTCTTTCTCTTCTCTCGC No data
Right 986007692 5:3681867-3681889 CTAGGTCCCCAGTTCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986007692 Original CRISPR CTAGGTCCCCAGTTCTCTCC TGG Intergenic
No off target data available for this crispr