ID: 986008979

View in Genome Browser
Species Human (GRCh38)
Location 5:3695057-3695079
Sequence GAGCTGCCACTGGGAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986008972_986008979 5 Left 986008972 5:3695029-3695051 CCACCATGCTGGTGGAGACGGGA No data
Right 986008979 5:3695057-3695079 GAGCTGCCACTGGGAATGGGTGG No data
986008973_986008979 2 Left 986008973 5:3695032-3695054 CCATGCTGGTGGAGACGGGACTT No data
Right 986008979 5:3695057-3695079 GAGCTGCCACTGGGAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986008979 Original CRISPR GAGCTGCCACTGGGAATGGG TGG Intergenic
No off target data available for this crispr