ID: 986011231

View in Genome Browser
Species Human (GRCh38)
Location 5:3717614-3717636
Sequence TGTTTAAGAGGACCACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986011228_986011231 12 Left 986011228 5:3717579-3717601 CCTTCTTTTTCTGAGTAGATCTT No data
Right 986011231 5:3717614-3717636 TGTTTAAGAGGACCACAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986011231 Original CRISPR TGTTTAAGAGGACCACAAGA GGG Intergenic
No off target data available for this crispr