ID: 986012278

View in Genome Browser
Species Human (GRCh38)
Location 5:3726664-3726686
Sequence TGCAGGAATTGCTACAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986012278_986012284 8 Left 986012278 5:3726664-3726686 CCAGAGCTGTAGCAATTCCTGCA No data
Right 986012284 5:3726695-3726717 AAGTGCAGCTCAGGGGCCACAGG No data
986012278_986012281 0 Left 986012278 5:3726664-3726686 CCAGAGCTGTAGCAATTCCTGCA No data
Right 986012281 5:3726687-3726709 TCAGCACCAAGTGCAGCTCAGGG No data
986012278_986012280 -1 Left 986012278 5:3726664-3726686 CCAGAGCTGTAGCAATTCCTGCA No data
Right 986012280 5:3726686-3726708 ATCAGCACCAAGTGCAGCTCAGG No data
986012278_986012282 1 Left 986012278 5:3726664-3726686 CCAGAGCTGTAGCAATTCCTGCA No data
Right 986012282 5:3726688-3726710 CAGCACCAAGTGCAGCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986012278 Original CRISPR TGCAGGAATTGCTACAGCTC TGG (reversed) Intergenic
No off target data available for this crispr