ID: 986014227

View in Genome Browser
Species Human (GRCh38)
Location 5:3743713-3743735
Sequence CACTGTCACCATAAAGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986014222_986014227 25 Left 986014222 5:3743665-3743687 CCTCTTATAAATCACTGCTATTT No data
Right 986014227 5:3743713-3743735 CACTGTCACCATAAAGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986014227 Original CRISPR CACTGTCACCATAAAGAGGG GGG Intergenic
No off target data available for this crispr