ID: 986014366

View in Genome Browser
Species Human (GRCh38)
Location 5:3745027-3745049
Sequence ATGAAGATCAAAAAGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986014362_986014366 28 Left 986014362 5:3744976-3744998 CCATCATCTGACAGTTCAACCGC No data
Right 986014366 5:3745027-3745049 ATGAAGATCAAAAAGCAGCAAGG No data
986014363_986014366 9 Left 986014363 5:3744995-3745017 CCGCTAACATCTGAAGTCTCTGC No data
Right 986014366 5:3745027-3745049 ATGAAGATCAAAAAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986014366 Original CRISPR ATGAAGATCAAAAAGCAGCA AGG Intergenic
No off target data available for this crispr