ID: 986014706

View in Genome Browser
Species Human (GRCh38)
Location 5:3747781-3747803
Sequence ACTAGGCAGTGCCCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986014706_986014714 21 Left 986014706 5:3747781-3747803 CCCCCACTGGGGCACTGCCTAGT No data
Right 986014714 5:3747825-3747847 CCATCCTCCAGACCCCAGAATGG No data
986014706_986014711 -6 Left 986014706 5:3747781-3747803 CCCCCACTGGGGCACTGCCTAGT No data
Right 986014711 5:3747798-3747820 CCTAGTGAAGCTATGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986014706 Original CRISPR ACTAGGCAGTGCCCCAGTGG GGG (reversed) Intergenic