ID: 986014706 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:3747781-3747803 |
Sequence | ACTAGGCAGTGCCCCAGTGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
986014706_986014714 | 21 | Left | 986014706 | 5:3747781-3747803 | CCCCCACTGGGGCACTGCCTAGT | No data | ||
Right | 986014714 | 5:3747825-3747847 | CCATCCTCCAGACCCCAGAATGG | No data | ||||
986014706_986014711 | -6 | Left | 986014706 | 5:3747781-3747803 | CCCCCACTGGGGCACTGCCTAGT | No data | ||
Right | 986014711 | 5:3747798-3747820 | CCTAGTGAAGCTATGAGAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
986014706 | Original CRISPR | ACTAGGCAGTGCCCCAGTGG GGG (reversed) | Intergenic | ||