ID: 986016339

View in Genome Browser
Species Human (GRCh38)
Location 5:3760824-3760846
Sequence ACTCCAGGCGTGGGGAGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986016330_986016339 8 Left 986016330 5:3760793-3760815 CCTTGATCCTGCAATAGAATCCA No data
Right 986016339 5:3760824-3760846 ACTCCAGGCGTGGGGAGCCGTGG No data
986016327_986016339 25 Left 986016327 5:3760776-3760798 CCAATATTCCAATAGACCCTTGA No data
Right 986016339 5:3760824-3760846 ACTCCAGGCGTGGGGAGCCGTGG No data
986016329_986016339 9 Left 986016329 5:3760792-3760814 CCCTTGATCCTGCAATAGAATCC No data
Right 986016339 5:3760824-3760846 ACTCCAGGCGTGGGGAGCCGTGG No data
986016333_986016339 1 Left 986016333 5:3760800-3760822 CCTGCAATAGAATCCAGAGGGAA No data
Right 986016339 5:3760824-3760846 ACTCCAGGCGTGGGGAGCCGTGG No data
986016328_986016339 17 Left 986016328 5:3760784-3760806 CCAATAGACCCTTGATCCTGCAA No data
Right 986016339 5:3760824-3760846 ACTCCAGGCGTGGGGAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986016339 Original CRISPR ACTCCAGGCGTGGGGAGCCG TGG Intergenic