ID: 986016392

View in Genome Browser
Species Human (GRCh38)
Location 5:3761300-3761322
Sequence GAGGGCACGTGCACACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986016392_986016401 11 Left 986016392 5:3761300-3761322 CCTGTGTGTGTGCACGTGCCCTC No data
Right 986016401 5:3761334-3761356 CTGGCCTTTGCGTCTCTGTGTGG No data
986016392_986016402 12 Left 986016392 5:3761300-3761322 CCTGTGTGTGTGCACGTGCCCTC No data
Right 986016402 5:3761335-3761357 TGGCCTTTGCGTCTCTGTGTGGG No data
986016392_986016393 -8 Left 986016392 5:3761300-3761322 CCTGTGTGTGTGCACGTGCCCTC No data
Right 986016393 5:3761315-3761337 GTGCCCTCCCTCCATCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986016392 Original CRISPR GAGGGCACGTGCACACACAC AGG (reversed) Intergenic