ID: 986016737

View in Genome Browser
Species Human (GRCh38)
Location 5:3764019-3764041
Sequence CTCCTCTACAGCTGCCCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986016737_986016741 -8 Left 986016737 5:3764019-3764041 CCGACGGGGCAGCTGTAGAGGAG No data
Right 986016741 5:3764034-3764056 TAGAGGAGTCAGGAGAAGGCGGG No data
986016737_986016742 -5 Left 986016737 5:3764019-3764041 CCGACGGGGCAGCTGTAGAGGAG No data
Right 986016742 5:3764037-3764059 AGGAGTCAGGAGAAGGCGGGAGG No data
986016737_986016743 8 Left 986016737 5:3764019-3764041 CCGACGGGGCAGCTGTAGAGGAG No data
Right 986016743 5:3764050-3764072 AGGCGGGAGGTGACACTGACAGG No data
986016737_986016740 -9 Left 986016737 5:3764019-3764041 CCGACGGGGCAGCTGTAGAGGAG No data
Right 986016740 5:3764033-3764055 GTAGAGGAGTCAGGAGAAGGCGG No data
986016737_986016744 9 Left 986016737 5:3764019-3764041 CCGACGGGGCAGCTGTAGAGGAG No data
Right 986016744 5:3764051-3764073 GGCGGGAGGTGACACTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986016737 Original CRISPR CTCCTCTACAGCTGCCCCGT CGG (reversed) Intergenic
No off target data available for this crispr