ID: 986016742

View in Genome Browser
Species Human (GRCh38)
Location 5:3764037-3764059
Sequence AGGAGTCAGGAGAAGGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986016737_986016742 -5 Left 986016737 5:3764019-3764041 CCGACGGGGCAGCTGTAGAGGAG No data
Right 986016742 5:3764037-3764059 AGGAGTCAGGAGAAGGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986016742 Original CRISPR AGGAGTCAGGAGAAGGCGGG AGG Intergenic
No off target data available for this crispr