ID: 986018529

View in Genome Browser
Species Human (GRCh38)
Location 5:3779503-3779525
Sequence GTGGAACTCCACTACAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986018529_986018541 14 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018541 5:3779540-3779562 AGGAGGGCTGGCCCGGAGTGGGG No data
986018529_986018540 13 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018540 5:3779539-3779561 GAGGAGGGCTGGCCCGGAGTGGG No data
986018529_986018536 2 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018536 5:3779528-3779550 CGCCTTTTCAGGAGGAGGGCTGG No data
986018529_986018534 -2 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018534 5:3779524-3779546 ACCGCGCCTTTTCAGGAGGAGGG No data
986018529_986018533 -3 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018533 5:3779523-3779545 CACCGCGCCTTTTCAGGAGGAGG No data
986018529_986018530 -9 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018530 5:3779517-3779539 GAGTTCCACCGCGCCTTTTCAGG No data
986018529_986018538 7 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018538 5:3779533-3779555 TTTCAGGAGGAGGGCTGGCCCGG No data
986018529_986018539 12 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018539 5:3779538-3779560 GGAGGAGGGCTGGCCCGGAGTGG No data
986018529_986018531 -6 Left 986018529 5:3779503-3779525 CCATTTCTGTAGTGGAGTTCCAC No data
Right 986018531 5:3779520-3779542 TTCCACCGCGCCTTTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986018529 Original CRISPR GTGGAACTCCACTACAGAAA TGG (reversed) Intergenic
No off target data available for this crispr