ID: 986018861 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:3782076-3782098 |
Sequence | CTGTATACACATTTGCAACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
986018857_986018861 | 9 | Left | 986018857 | 5:3782044-3782066 | CCTATGGCTAGCTCCTAAAATAT | No data | ||
Right | 986018861 | 5:3782076-3782098 | CTGTATACACATTTGCAACTTGG | No data | ||||
986018859_986018861 | -4 | Left | 986018859 | 5:3782057-3782079 | CCTAAAATATGCATGAGGCCTGT | No data | ||
Right | 986018861 | 5:3782076-3782098 | CTGTATACACATTTGCAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
986018861 | Original CRISPR | CTGTATACACATTTGCAACT TGG | Intergenic | ||
No off target data available for this crispr |