ID: 986018861

View in Genome Browser
Species Human (GRCh38)
Location 5:3782076-3782098
Sequence CTGTATACACATTTGCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986018857_986018861 9 Left 986018857 5:3782044-3782066 CCTATGGCTAGCTCCTAAAATAT No data
Right 986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG No data
986018859_986018861 -4 Left 986018859 5:3782057-3782079 CCTAAAATATGCATGAGGCCTGT No data
Right 986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986018861 Original CRISPR CTGTATACACATTTGCAACT TGG Intergenic
No off target data available for this crispr