ID: 986021961

View in Genome Browser
Species Human (GRCh38)
Location 5:3812828-3812850
Sequence TAGAAGGCTTTGCTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986021953_986021961 15 Left 986021953 5:3812790-3812812 CCATCTGTGGTGGGAGAAAACCC No data
Right 986021961 5:3812828-3812850 TAGAAGGCTTTGCTGTGGGGTGG No data
986021955_986021961 -6 Left 986021955 5:3812811-3812833 CCAGACATGCCAGACTGTAGAAG No data
Right 986021961 5:3812828-3812850 TAGAAGGCTTTGCTGTGGGGTGG No data
986021954_986021961 -5 Left 986021954 5:3812810-3812832 CCCAGACATGCCAGACTGTAGAA No data
Right 986021961 5:3812828-3812850 TAGAAGGCTTTGCTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986021961 Original CRISPR TAGAAGGCTTTGCTGTGGGG TGG Intergenic
No off target data available for this crispr