ID: 986023342

View in Genome Browser
Species Human (GRCh38)
Location 5:3825376-3825398
Sequence ACGCATGTGGACGGCTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986023342_986023347 6 Left 986023342 5:3825376-3825398 CCAGGACAGCCGTCCACATGCGT No data
Right 986023347 5:3825405-3825427 GAAGTCCCCTCAGGCTCTGCTGG No data
986023342_986023345 -3 Left 986023342 5:3825376-3825398 CCAGGACAGCCGTCCACATGCGT No data
Right 986023345 5:3825396-3825418 CGTCCACGTGAAGTCCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986023342 Original CRISPR ACGCATGTGGACGGCTGTCC TGG (reversed) Intergenic
No off target data available for this crispr