ID: 986023345

View in Genome Browser
Species Human (GRCh38)
Location 5:3825396-3825418
Sequence CGTCCACGTGAAGTCCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986023342_986023345 -3 Left 986023342 5:3825376-3825398 CCAGGACAGCCGTCCACATGCGT No data
Right 986023345 5:3825396-3825418 CGTCCACGTGAAGTCCCCTCAGG No data
986023341_986023345 -2 Left 986023341 5:3825375-3825397 CCCAGGACAGCCGTCCACATGCG No data
Right 986023345 5:3825396-3825418 CGTCCACGTGAAGTCCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986023345 Original CRISPR CGTCCACGTGAAGTCCCCTC AGG Intergenic
No off target data available for this crispr