ID: 986026088 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:3852766-3852788 |
| Sequence | GTGAAAGCAGGACACCCGCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986026088_986026092 | 24 | Left | 986026088 | 5:3852766-3852788 | CCGTGCGGGTGTCCTGCTTTCAC | No data | ||
| Right | 986026092 | 5:3852813-3852835 | ACATGCAGACCTCACTGTCAGGG | No data | ||||
| 986026088_986026091 | 23 | Left | 986026088 | 5:3852766-3852788 | CCGTGCGGGTGTCCTGCTTTCAC | No data | ||
| Right | 986026091 | 5:3852812-3852834 | CACATGCAGACCTCACTGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986026088 | Original CRISPR | GTGAAAGCAGGACACCCGCA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||