ID: 986026088

View in Genome Browser
Species Human (GRCh38)
Location 5:3852766-3852788
Sequence GTGAAAGCAGGACACCCGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026088_986026091 23 Left 986026088 5:3852766-3852788 CCGTGCGGGTGTCCTGCTTTCAC No data
Right 986026091 5:3852812-3852834 CACATGCAGACCTCACTGTCAGG No data
986026088_986026092 24 Left 986026088 5:3852766-3852788 CCGTGCGGGTGTCCTGCTTTCAC No data
Right 986026092 5:3852813-3852835 ACATGCAGACCTCACTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026088 Original CRISPR GTGAAAGCAGGACACCCGCA CGG (reversed) Intergenic