ID: 986026090

View in Genome Browser
Species Human (GRCh38)
Location 5:3852778-3852800
Sequence TAGTGAAGCCATGTGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986026090_986026091 11 Left 986026090 5:3852778-3852800 CCTGCTTTCACATGGCTTCACTA No data
Right 986026091 5:3852812-3852834 CACATGCAGACCTCACTGTCAGG No data
986026090_986026092 12 Left 986026090 5:3852778-3852800 CCTGCTTTCACATGGCTTCACTA No data
Right 986026092 5:3852813-3852835 ACATGCAGACCTCACTGTCAGGG No data
986026090_986026094 27 Left 986026090 5:3852778-3852800 CCTGCTTTCACATGGCTTCACTA No data
Right 986026094 5:3852828-3852850 TGTCAGGGCACGTATAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986026090 Original CRISPR TAGTGAAGCCATGTGAAAGC AGG (reversed) Intergenic
No off target data available for this crispr